NABSYS
Laboratory equipment, namely, bio-analytical devices using electronic detection for nucleic acid analysis and molecular…
Owned by: NABsys, Inc.
Serial Number: 85022745
N
Laboratory equipment, namely, bio-analytical devices using electronic detection for nucleic acid analysis and molecular…
Owned by: NABsys, Inc.
Serial Number: 85022774
NABSYS ACTGATCCGATCTTACTGAGATAAACTGAACTG
Laboratory equipment, namely, bio-analytical devices using electronic detection for nucleic acid analysis and molecular…
Owned by: NABsys, Inc.
Serial Number: 85022778
Image Trademark
laboratory equipment, namely, bio-analytical devices using electronic detection for nucleic acid analysis and molecular…
Owned by: NABsys, Inc.
Serial Number: 85549484
NABSYS
laboratory equipment, namely, bio-analytical devices using electronic detection for nucleic acid analysis and molecular…
Owned by: NABsys, Inc.
Serial Number: 85549577
